Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YP14FM1
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00004500001 E-value : 1e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08334
Accession: ref|XP_001798654.1| Score: 164 E_value: 2e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG04123.1 Score: 156 E_value: 3e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB2YP14FM1
TTGGCGACAAATGGTCATTCCCCATCTCGGGCATTTGGTTAATTTGTGGT
TCAGGGTAGATCCTCACCTTTTTCACATCTGGACGACGGGACGATCCACT
ACGGATGCTGCGGGCATCAAGCATTTCAAATTCGTCCTCATCAAAAGAGG
ACCCTTCGTACGCCTCACTGGCGTATTCGTCCTCATCTGCGGCCTCCTCT
TCGTGGGGCTTCACGACCATCAACATAAAGGTCATAGACCTCATTGCTGT
ATGGATTACCTTCGATTTCATCCGCGTACTCCGCCATACGGTCATCCCGG
CGTCGGGGCGCTTCGCGAACAGTCCTCGATCTTGACGCGACTGAGGCTGA
AGAGGAGGAGGAAGGGGCACGTGTTGAGTAGGCACGACGAGGTTCTAGTT
GACCCCGAACAATGCAGTATCTGACCTTCGGCGGGGAATCAGCTCCGATT
TGACAAGTTTCGTCGCAGCAAATGAGATGTCCGTTCGATCGTCTATTGGA
GCGGTTTCCGACATATTCTGCTGCGGACCAAATTTAGCTTAAAGCTTCAC
AGGTATTCACGATTTTCGGACACACCTTCTTAACCTCCGTCCCTGCAAAG
CCTGTGAATGCATTCTGGGCATCCGATGCTGCAACCAATCTTGGCTTTCC
TAGGTAATCCTTGGCCTTCACATTTTTGACCTTGGCCTCATT

Sequences in the Contig:

SY0AAB2YP14FM1