Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YO02FM1
Length(NT) : 444
Best Gene Model Blast : Link to GSTUMT00007753001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12741
Accession: ref|XP_001586166.1| Score: 237 E_value: 8e-19
KEGG Definition: hypothetical protein
Accession: ncr:NCU02826.1 Score: 212 E_value: 3e-16
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2399 Score: 174 E_value: 5e-14
PFAM Definition: No Hit Found
Swissprot: P87122|YDL6_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB2YO02FM1
TTGGGGGGGGATCTCAAACCAGCGATAAGACGCCGACAGTAGTCCTCGAA
CCTGAAAGCCCTGCCAGCACTATTACGGGAGGAGACCTGATGTCTACCAA
TGGCGCTTCTAGTGGCCCTGGGCATGGAGTGAGCGCATCAGATGGCGTTG
GCCCAAAAGAGTGGAATAGATGGCTAGTAGCAATACAATGCATCACTGCC
CCGGTCTTCATGGTTGTCATGTTTCTTGCAGATGATGAGATCCGACTGCT
GAAGCCCATCCTCTATGCACTTCTTGGGGGATTGATCGCGTTAGCATTTT
TACTTATTCTCACCACTCCAGAGAGGGCACCGCGGTGGAGATATCTTCTT
TGTTTTGCTGGATTTGCCGTGGCCATTGGGTGGATCAGCGCCATTGCCAA
TGAGGTGGTAGGCGTTTTGAAGGCGTTTGGAGTCATATTTGGTA

Sequences in the Contig:

SY0AAB2YO02FM1