Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YN18FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00000577001 E-value : 1e-159
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00602
Accession: ref|XP_368642.2| Score: 173 E_value: 5e-11
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00602 Score: 173 E_value: 2e-11
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4571 Score: 111 E_value: 2e-06
PFAM Definition: bZIP_1, bZIP transcription factor. The Pfam entry includes the basic region and the leucine zipper region..
Pfam Number: pfam00170 Score: 123 E_value: 7e-08
Swissprot: P11115|CPC1_NEUCR

Sequence:
>SY0AAB2YN18FM1
TTGGCCCCAGAGCAGTCCGGTTGGGGATCTTCATCTAAACGTCCAGGAAG
ATCCCCAGAGCAGTCCGGTTGGGGCATATTGGGCATAGTGGGGGAAACAA
CAGAGTCCTCAGGATCAGGATTCCCCTAGCACCTCCCCCCGCTATCGCAG
CCAAAGCGTATCTACACAGCGACGTTCGGCAACTTCTGGCGTTCGAAAGA
GGGCGCCTTTGCCGCCCATTGTCGTTGAAGATCCGTCTGATACTGTCGCC
ATGAAGCGTGCGCGAAACACCCTCGCTGCCCGAAAGTCGCGAGCTAAGAA
ATTGGAGCGAATGGAGGAGATGGAGGCCCAGATTGAGGAACTTAAGGCTG
AGGTTGAGCTATGGAAAGATCGAGCCCTCGGCCATCCTCGCAGGGTTTGA
TTTGGCTTTTCTCGGAGGAAGTGTTTTTTCTTATCTTAATTCCTTTTAAC
TTGTATTTTTGATGCTGGTTTGTCTCTTGTGAAGGCGGATGTAATTGGAG
GAAAGTGCACATTTTCATTCTTTTTCTATTTCCGTATCTTGAAGCTTCCC
GCGACCATTTGCGCTTTTAACGACACGTTACGACTTTGTTTCTTTCTCCA
CATTTTATGGGTTATACATTCTCTAGCCCTAATTTATCCT

Sequences in the Contig:

SY0AAB2YN18FM1