Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YM23FM1
Length(NT) : 443
Best Gene Model Blast : Link to GSTUMT00008369001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 250 E_value: 3e-20
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 230 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB2YM23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAAGATCCTGGATAAAAG
CCCAGACCCCGGCAAAGCTCGGCGGATCCTGCAGATAGTGGTAGCAGCCG
CAAGACCGCTTACAACCGCGGAAATGAATGTTGCAGTTCGGATCACACGG
GATCACAAATCAGTGAGGGAGCTCTCAGGCGCTGTGTGCGGTGGGTTTGA
GAAGACAGTGAAAAAGTTCTGTGGGCTTTTCATACGGGTCATCGATTCGA
AGATTTACCTCGTTCACCAGACCGCGAGGGAGTTCCTAATTAAGGGATCT
TTGCTGGGCAAGGGTAACTGGCAATACACACTGTGCCTCAAGGATTCTAA
CTTCACAGTTGCTGACATTTGTATTTCCTACCTTTCGAGAGAGGAGTTTA
TGGGCAGCCCATTAGAGATAGACATTATGGGCTATGTTTCACC

Sequences in the Contig:

SY0AAB2YM23FM1