Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YM20FM1
Length(NT) : 508
Best Gene Model Blast : Link to GSTUMT00007513001 E-value : 2e-92
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1546 Score: 150 E_value: 4e-11
PFAM Definition: No Hit Found

Sequence:
>SY0AAB2YM20FM1
TTGGCAGTGCCGATGCTACTGAGGGCGGAGAAGCTACTGGTGCCATGAGT
TATGCATTCATCAGAGCTCTCAGCAAGAACTCGCAGCAATCTTACCAGCA
ACTTCTCAACAGCATTCGGGAAGAATTGCAAGGGAAATACTCCCAGAAAC
CCCAGCTTAGCTGTAGCCATCCACTAGGTACAGACGGTTATCCCCTTGAT
TCTTCGCAGATGGAGTTTAAGTTTTAGGTTTTCAACTTCTCCTTTTCATC
TCATGTCTTCCATACACTTCCAGGGTTATCAATAACGGCATTACTTTGTA
TTTTTAAGATTTCCTTCTCGTTTTCCTTCCTTTCTTTATTTTTACTTCTG
CTTTGGTCGGAATCTCCTTGTACTTCACATGTTTTTTTTTAATCTTTTTG
GCTTTCGATTTTACGAGCTCTACTGTTGGCGTCTAGGACGAAAATTTTAA
CGTACGTTGGGTCACTTTAGATACGAGGTTGCTCTACGTTATGTAGGCGC
CAGAAAAT

Sequences in the Contig:

SY0AAB2YM20FM1