Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YM11FM1
Length(NT) : 485
Best Gene Model Blast : Link to GSTUMT00005375001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_14024
Accession: ref|XP_001585164.1| Score: 156 E_value: 6e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU06532.1 Score: 148 E_value: 3e-16
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1436 Score: 157 E_value: 6e-12
PFAM Definition: DHO_dh, Dihydroorotate dehydrogenase..
Pfam Number: pfam01180 Score: 112 E_value: 1e-06
Swissprot: Q6CTX8|PYRD2_KLULA
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>SY0AAB2YM11FM1
TTGGGGTCCTTGCAGAAGCGCGAGAGTCTGCAGGAATTGCTAGCTGTCGT
AGTGCTTGCGGCGCAGAAGGCTGACAGGAAGGTCAAGCCGAAGGTTGTTG
TCAAGATTTCCCCGGATAGCGATGGCGTAGAGGATATCAAGGGCATTTCC
GCCGCTGTCAAGTTCGCCGGCGTCGCAGGGGTCATTGTAGCGAACACCAC
TGTCAAGAGGCCACTGAGCGTGCTTGCCTCGCCGCAGGTATCTGAGGAGG
AGAAGAGGGTGTTTCACAAAGAGATTGGAGGACTCTCTGGACCGGTGCTG
CTGCGGAATATGTTGAAGCTTGTCGAGAGGTATTCCAAGGAGCTTGGGCG
ATAACGCTGTTGTTTTTGCCTCTGGAGGGATCACCAGTGGGAAGGACGTC
CTAGAGGCTAGGAAACGTGGTGCTAAGATTGTCATGGGGTACACCGGCAT
GGTCTATGATGGTGTCGGCTTCTTTGGCAGGATCG

Sequences in the Contig:

SY0AAB2YM11FM1