Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YL07FM1
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00009084001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61825.1| Score: 807 E_value: 2e-84
KEGG Definition: glycinamide ribonucleotide synthetase (GARS)/Aminoimidazole ribonucleotide synthetase (AIRS) [EC:6.3.3.1 6.3.4.13]; K01933 phosphoribosylformylglycinamidine cyclo-ligase; K01945 phosphoribosylamine--glycine ligase
Accession: aor:AO090701000066 Score: 807 E_value: 8e-85
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG0237 Score: 721 E_value: 5e-77
PFAM Definition: GARS_A, Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain. Phosphoribosylglycinamide synthetase catalyses the second step in the de novo biosynthesis of purine. The reaction catalysed by Phosphoribosylglycinamide synthetase is the ATP- dependent addition of 5-phosphoribosylamine to glycine to form 5'phosphoribosylglycinamide. This domain is related to the ATP-grasp domain of biotin carboxylase/carbamoyl phosphate synthetase (see pfam02786)..
Pfam Number: pfam01071 Score: 404 E_value: 2e-40
Swissprot: P20772|PUR2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB2YL07FM1
TTGGATCGCTTCCGCCAGCCCAAGATCACAAGAGAATATTTGATGGTGAC
CAAGGTCCTAATACCGGTGGTATGGGATGCTATGCTCCAACCCGCATTGC
CCCGCAATCTGTTATCGATCAGATCCACAAAACGATTTTACAGCCAACAA
TTGATGGAATGAGGCGTGAAGGATATCCTTTCAGGGGGGTGCTGTTTACC
GGTCTGATGATGACCAAGAGTGGACCTAAAGTATTAGAGTATAATGTCAG
ATTCGGTGACCCAGAGACACAAACCCTTTTGCCCTTGATTAGTGAAGACA
CCGATTTTGCCGAAGTGCTGCTAGCTGCTGCGAACGGATATCTTGACGGG
ATAAAAATCAAGATCAACCCTGGCTTCGGAGCGACTGTTGTTGCTTCTGC
GGGTGGATATCCTGGGCCTTACGCCAAAGGAAAGGAAATTAGACTGGATC
CTGTTAAGAAAGATACAAACGTATTCCATGCGGGAACTTTATTAAAGGAT
GGGAAAATTTACTCTAGTGGAGGGCGAGTGATAGCAGCTTCAGCAACCGC
TGATACCCTGGAGGGTGCGGTCGGTAACGCTTATGATGGAATGGCGGCTA
TTGATTTCAGAGATATGTTTTACCGAAATGATATTGCTCATAGAGCCTTT
AAGCAGGTAGCGCCGACGGAATCTATGACTTAT

Sequences in the Contig:

SY0AAB2YL07FM1