Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YL04FM1
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00011946001 E-value : 1e-155
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_08297
Accession: ref|XP_001553573.1| Score: 357 E_value: 2e-53
KEGG Definition: calcium P-type ATPase [Neurospora crassa OR74A] )
Accession: ncr:NCU03305.1 Score: 325 E_value: 2e-51
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0202 Score: 264 E_value: 4e-24
PFAM Definition: E1-E2_ATPase, E1-E2 ATPase..
Pfam Number: pfam00122 Score: 247 E_value: 4e-22
Swissprot: Q9SY55|ECA3_ARATH

Sequence:
>SY0AAB2YL04FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAGTTCAGTGAACACGAA
CACCGAAACTGCAAGGCAACGACTTAATTATCAAGCTGCGGTAATGGATC
GCGCTTATGCTCGGACTGCTGAAGATACTTTAAACTTCTTCAACGTCGAT
GAGCGCACTGGCCTTGACGACCAGCGGGTGAAAGCTGCGATTTTGAGATA
TGGGAGAAATGCACTCCCAGAGGAACCTCCGACCCCATTATGGCAGCTTG
TCCTGGAGCAATTTAAGGATCAGTTGGTGATAATATTATTGGCATCTGCG
GCTGTGTCGTTCGTATTGGCTTTTCTGGAGGAGGGTACCAGCCTGACAGC
TTTTGTCGACCCTGCTGTTGTGAGCGATCCTTTTTACATATCACTGACTT
ACGTTTTGAGTAAAATTGCTGATGTTTGGCGAAGATTCTCACTATCTTGA
TTCTCAACGCGGTTGTGGGTGTTTCCCAAGAAAGTAGTGCCGAAAAGGCG
ATTGCTGCCCTTCAGGAATATTCTGCCAACGAAGCAAAAGTTGTGCGCAA
TGGCCATGTCTCTAGGATTCGTGCTGAAGAGCTTGTCCCCGGTGATATAG
TCGACGTAGCAGTCGGCGATCGGATACCCGCCGACTGTCGCGTAATTGCC
ATCATGAGCAACACTTTCCGTGTC

Sequences in the Contig:

SY0AAB2YL04FM1