Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YK05FM1
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00012108001 E-value : 1e-124
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_747929.2| Score: 325 E_value: 6e-29
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G04150 Score: 325 E_value: 3e-29
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0543 Score: 104 E_value: 8e-06
PFAM Definition: No Hit Found
Swissprot: P53870|YNT3_YEAST

Sequence:
>SY0AAB2YK05FM1
TTGGCCCTCCCGCCACTTGTAAAGTGAATCCCCCCCCCCGCAATGCCTAA
ACGTAGGTTCCCGCCTGTTCGCAGTAACAAGCGGAAGAAGGAGCTCCCGG
AAACTTCAGAGGAATTCCTTGATGCTGGTATTGGATTGGAGGAGTCTGGG
GACCGGTGGAGGGCTGGGGATAAAGCTAAGGCTGGGAGGTTCTACTTTAA
GGCTATAGAGAGTTACGAGGCGGCGTTGGAGAGGAATTCGAGGTCTTTTG
ATGCGACTTATAATAGAGCGCGTTTGCTATACCAGCTAGCACAACACCAA
AACCTGCTCCCCACTCCTTCAGACGTAACCTCAAAATTGCTATTAGAGAA
GGCAGTGCAGAGCCATCGGGAATGCCTAGTTTTGGATCCCGACAATCAAG
ATGCCTTATTCAACACGGGGCAAGCACTTTGCAGCCTTGCTGAAGCCCTG
GTCGAGTATAAGAACACACCTATCGAAGCGCGGTCTGAAGCTTGGAAATT
TTTGT

Sequences in the Contig:

SY0AAB2YK05FM1