Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YG09FM1
Length(NT) : 281
Best Gene Model Blast : Link to GSTUMT00007435001 E-value : 1e-156
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05386
Accession: ref|XP_001556015.1| Score: 228 E_value: 9e-18
KEGG Definition: anucleate primary sterigmata (ApsB), putative
Accession: afm:AFUA_3G05720 Score: 190 E_value: 1e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O60039|APSB_EMENI

Sequence:
>SY0AAB2YG09FM1
TTGGGACATTGTCGTCAGACTAGAAGATGTGCACGAAGAACATGCCGGTG
AAGTACGAAGGCTGGAAGGGAAGATCGAAGATCTTCAGCGCACGCTGAGG
GAGAACGAACAGGAGATGAATGTTCTCGAGGAATCTCTACGTGATGCAAA
TGAGAAAATTGAGAGAATGACCGTCCAGAGCGAGAGCGCCAAAGGAGAGA
TTGCGTTCTTGCGGGAGGAACAGGATGCAGACAAGATCAAGATCGGAGAG
CTCGAAACGGTCATCAAAGGTCTCGAGAAGG

Sequences in the Contig:

SY0AAB2YG09FM1