Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YG05FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00005563001 E-value : 2e-43
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001216300.1| Score: 186 E_value: 1e-12
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB2YG05FM1
TTGGACCCCTCCCCCCCCACTTCTTTCGAAATCTCCTCTTCACTTCTCTT
CTCAACCTCAACCCTGGCAACGCTGCCCCCAACTTTACCAAACTTCCCAC
CAGTAAGCTCCCGCGCAACACTATTCAGCATCTCACCCCTCTCCAACCCC
CCATACTTCTGCATATCAACCTGCACATTAGCATGGCCGATCTCTATAGT
CTCCATCACAATCTCCAACTCTACACCCGCGGCGAGGCTCACAGCTCTCA
TCACGTCAGGGTGGGTCCAGATGTCCTTGAAGAACTGGGAGTGCGCGGCC
GTGTTGCGCACGATGAGGTTGTGGTTACTGTAGGGCGAGGCAGTTTTGTC
GAGGTAGTCTGGGTTCAGTAGGGCTTTGCGTAATAGCGGGATTGCCGCCT
GGGAAAAGAGTGGGAACGGAGCAGAGCCAGCGACCGGTGAGGCGGCGCCA
GCGGGGCGGGGGAGAGAGAGGTCCTTGAAGGTGATCTGTGCTGGTGGGGT
GGCCGAGATGTTTAAGTGCTTCTGTTGGGATAGCATTGGTTGTTAGTATT
TTATTCATTCGTTTGTCTAGGGAATGGAATGGGATGGGTTTGGAGGTGTT
TGCGCGGGAAGTGCAAACCG

Sequences in the Contig:

SY0AAB2YG05FM1