Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YF23FM1
Length(NT) : 540
Best Gene Model Blast : Link to GSTUMT00006971001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g02750
Accession: ref|XP_001394276.1| Score: 510 E_value: 2e-50
KEGG Definition: hypothetical protein
Accession: ang:An11g02750 Score: 510 E_value: 1e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2394 Score: 372 E_value: 9e-37
PFAM Definition: No Hit Found
Swissprot: Q9P4R5|CREC_EMENI
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0045013 = Biological process: negative regulation of transcription by carbon catabolites

Sequence:
>SY0AAB2YF23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCGAGTGGGGACATTGTG
TGGTTCGATCCAATCTCAAACAAATATGCAAGGCTAAACAAGAATGGCGT
GATAAACCCACACGCAGTTGCGGATATCAAATGGATACCGGGAACTGAGA
ATTTATTTCTAGCCGCCCACCAAGACGGATCTTTGATAGTATATGACAAA
GAGAAGGAGGATGCGCCATTTATGCCTGAGGATGCACCGGATGCTACTGG
AATGCCTGAGAAAGCTGCTACGGGATCCGATAGTACGGCAAGTCTCTTGA
GGTACTTTTCGGTGAACAAGTCGGTGGAGTCAAAAAACCAGAGAACCAAT
CCTGTTTCGTATTGGTCGATCTCTAGAAGTGCCATCACGGCCTTTGCCTT
CTCTCCGGACTGCCAATATGTTGCTGTGGTAGCTGAAGATCAATGTTTGC
GGGTCATTAATATTGTTAAGGAAAAACTTTTAGATGTTTACAGTAGCTAC
TATGGCGGGTTAATGTGTGTTTGTTGGTCTCCGGATGGAA

Sequences in the Contig:

SY0AAB2YF23FM1