Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YE10FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00007824001 E-value : 4e-69
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 564 E_value: 2e-56
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 506 E_value: 6e-50
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 276 E_value: 1e-25
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>SY0AAB2YE10FM1
TTGGCGGGCTAGATCATCAAGACACCTTACAGAGCGTTAACAATCTCGGT
GCGACTCTAGCTAGTCAAGGGAAATACGATGAGGCAGAGATTATACATAG
ATGTGCATTGGCGGGCAGGGAAAAAACGCTCGGGCTAGATCATCGAGATA
CCTTACAAAGCCTTCATGATCTGGGTGTGGCGCTACATTCTCTGGAAAAG
TACGGCGAGGCCGTAGATATGCATCGACGCGCATTGGCGGGCAGAGAGAA
GGGGCTTGGGCTAGATCATCAAGATACCTTAAAGAGTGTTAATAATCTCG
GCGCGACTCTGCATAGCCAAGGAAATTACAATGATGCCGAGGTTATGCAT
CGACGTGCATTGGCGGAAAGGGAGAAAACCCTAGGGATAGATCATCGAGA
TACCCTGCTGAGTGTCAACAATCTCGGTACGACTCTGCGTAGTCAAGGAA
GGTACGGCGAAGCTGAAATTATGTACCTACGCGCATTGGCGGGCAGAGAG
AAAACGCTCGGGTCAGATCATCGAGATACCTTACAGAGTGTTAAGGATCT
AGGTGTGGCATTGTATCGTCAGGAAAAGTACGATGAAGCGGAGATTATGC
GTCAACGTTCTTTCGCTGGGCTAGAGAAAGCCCTTGAGGTTGACGACCGG
GATTGCCTAG

Sequences in the Contig:

SY0AAB2YE10FM1