Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB2YD13FM1
Length(NT) : 600
Best Gene Model Blast : Link to GSTUMT00012216001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2202 Score: 108 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB2YD13FM1
TTGGCGGCGAAGGCGAGATCTTCTCTATCCTACCGAGCCAGAGCATCCTG
CCAAGTCCACACGGCCCAGGTATGAGTCGGCCCGGCTCCATAGACGACGG
CTATGGCGGCGGGGGCGGTAGCGTCACCACTGCAGCCGGCGCCAGCGCCA
CGGATGGAAAATACCAAAGCCTGACAGGCGCCCTATCCCACCATGGTGAC
TTTGACGGCTACGATGACGATGACGCCGGGAGTATATTCTCCGGCGGCTT
CTCGAATCCAGGATTAGACGGCAATGGAAATGGCGGCGGCCTCGGTAGAG
GAGCCGGGAGAGCCGGAATACCACCCTTCTCGCCATCCGCCAGTAGCGCT
GGCTGGGCAACCAGAACCGACTCGGCACACTCAGACGTCACACCGCCCAA
CCTACCATCTACACTTCGCGAGGAGGGGGACGCCGGGAGGAGCAGGAGAT
CAACTACTGCTACCACTGCCACCCTCACTGGCGGGTATAGGGAAGATGCT
GACGAACGGACGGAGGATGAAGGCAGTGTGGGGACTGACACCACCGTATA
ACGATGATGACTATGAACCGTGGTGATCCAAAAATATGAATAAATGTGTT

Sequences in the Contig:

SY0AAB2YD13FM1