Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YP15FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00012610001 E-value : 1e-134
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001586854.1| Score: 286 E_value: 3e-24
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00895 Score: 264 E_value: 5e-22
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3481 Score: 219 E_value: 5e-19
PFAM Definition: UPF0203, Uncharacterised protein family (UPF0203). This family of proteins is functionally uncharacterised..
Pfam Number: pfam05254 Score: 220 E_value: 4e-19
Swissprot: O60200|MDM35_YEAST
Gene Ontology:
GO:0005758 = Cellular component: mitochondrial intermembrane space
GO:0005634 = Cellular component: nucleus
GO:0007005 = Biological process: mitochondrion organization and biogenesis

Sequence:
>SY0AAB29YP15FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTACCACAAAGAATTACAA
ATGTCCTCATCCCTAGCACCCGAATGTTCCGAGAAGAAGGAGCGATACGA
TACCTGCTTTATAAAGTGGTATTCGGAGAAGTACTTGCGAGGAGAGGGCA
ACACGGATGAGTGTGAGGAGTTGTTTAAGGAGTATAAGAGCTGTTTGAAT
GCAGCTTTAAAGCAGAAAGGCATTCATAACATGATTGAGGAGGCTAGAAA
GACATCGCCGAATAATGACAACGTCAAGGGGTCGGAGTGATGGATGACCC
CCGGGGACGCGGTTTCCTGGCAGAGTTTTTGTTGCCGTGGTATGGAAGGT
GTGGAAGGCACATGCATAATATTATAGCGTTGTGATATCGGTAGCTGTTT
TGAAGCTTCCCGGATTATGGGTCTCGTGGATGTGTTCCGGTACCGTACAG
CATGCTCTGGGGCTATCTTGATCTTTGTTAGTAAATGTTTCTTCATCTCT
ACTCCTTTTTGGTGTTTTGTATTGAGGGCACTCTGATAGAGGGGTTCATA
AACTAGACGACAATATATTCTTCTGTCATGTCTTTG

Sequences in the Contig:

SY0AAB29YP15FM1