Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YO18FM1
Length(NT) : 724
Best Gene Model Blast : Link to GSTUMT00011622001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g09740
Accession: ref|XP_001394932.1| Score: 470 E_value: 2e-45
KEGG Definition: hypothetical protein
Accession: ang:An11g09740 Score: 470 E_value: 1e-45
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0646 Score: 283 E_value: 3e-26
PFAM Definition: No Hit Found
Swissprot: Q10272|IPI3_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB29YO18FM1
TTGGACCAACCCCTCCAACAACAAAATGCTCAACGAACAGGTGGCTATTT
CAACTTTCCGGCCGACACCAGACATCTCTAGTACTGCAACAGCAGAACCT
GTGATTTCCATCTACAATTTACACACATTCTCTCAAACTGCTGCTTTCAA
ACGATCCACGACCGCTAAGAATTGTCTTGCAGTAACAGATTCACATCTGT
TTGCTGCGCAAAGCGATAAGGCAGTTGTAAACATATACAGTCGAGAGAAA
GGGAGTTTAGAGACCACAGTTCCGTTCAAAGAAAAATTTACTGTTCTCGA
GGCTGGCAGTCAGGAAATTATTGCCGGAGGAACTGAAGATGGAAGACTAT
TGCTTTGGGAGACTGCTACGGGACGATATATATCTACTCAACAAGCTCAC
CTCCAAAGACTTACCAGCATAGTCTTTGATTGCTCTTCGAACTTTGTTAT
CACTGGCTCTGCCGATAGTAATGTGTGTGTTTGGTCGATACCTGCCCTCC
TCGACATACGAACTGGTGAACGCTCGCCTCTTTATACTCTGGACCGACAC
ACTCGAGAGATTACTGCGCTTGCTACCGGGAGAGTGGCAGCTGGTGGGCC
TTCCGATATTCTGCTCACTGCTTCCCGGGATCAATCTGTCGCCGCCTGGG
ACTTCCACACCGGCACTCATCTACGAACTTACATCTTCTCTTCAATTCCG
ACGTGCCTTGCCATTGATCCCGCA

Sequences in the Contig:

SY0AAB29YO18FM1