Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YO03FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00011700001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15503
Accession: ref|XP_001805649.1| Score: 163 E_value: 6e-10
KEGG Definition: hypothetical protein
Accession: ani:AN8807.2 Score: 163 E_value: 3e-10
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG2122 Score: 112 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB29YO03FM1
TTGGCCCAAGGCGAGGTATTTGGATGAGTTGAATGGTGTGGCCGGGTCTA
AGGATGCTGGCATTGGCGGAGGCGGGAAGGTTAAGGAGCGTGCAGCGGGT
TGGAGGGATATCAAAACGATCGATCAGTTCTGGGAATTGATGAGTTTTCG
GCAGGAGTGCTCGCTTGGTCGGTGTGTTGGATTCTTATGGATTGTTGTTG
AGGGGGTCAAGAAGGAGCGGAAGATGACTGCTACTGGCCTGAGCGGGGAA
GGCATTCCAGAAGATGAGGTTGTGCTTTCACCCATTTCTGCTACTGGCCC
GACCTTCTCGGAGAACATCCTCGGCGCGGCCGCTACCGCCAGCAACAGCA
GTCAGGAGATATCACCAACAGAGAGTGTTGGCCCTCTTGACTTTACCACT
ACCTCCATACCCCCACCAACGGAAACGCCGACACCAGCGTCAACCCCTCC
TTCCCCAGCTTCCCCACGAAAGCGCCGCTCCTCCTCTACCACCTCCTTCC
AACCTTCAAAAAAGAAGCTTCGAGCGCTAAGCTTTTCACCCGCCCCATCT
TCTGCCACCGCACCACTTATCCCCCCGCTCCTGGCACTCGACGAAAAAGC
GTACGTTAGGACCATTGATAGCCTACTAAACCATTCTG

Sequences in the Contig:

SY0AAB29YO03FM1