Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YL19FM1
Length(NT) : 490
Best Gene Model Blast : Link to GSTUMT00004039001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05352
Accession: ref|XP_001795758.1| Score: 222 E_value: 5e-17
KEGG Definition: predicted protein
Accession: aor:AO090003000065 Score: 145 E_value: 2e-08
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4249 Score: 118 E_value: 2e-07
PFAM Definition: DUF647, Protein of unknown function, DUF647..
Pfam Number: pfam04884 Score: 137 E_value: 1e-09

Sequence:
>SY0AAB29YL19FM1
TTGGGATGGGGTGGATCTGGGGTTCTTGGAAACGCCGAAATCGGCGTCAA
GTTGACGGCGCTGATCCGCTCGCTTCGTCAATCTCCGGAGCGCAAGAAGG
AGGGGGAGGGGGAGGGCGTCAGCCCCGTCGAACTCGCGAGCGTATTCCAG
AACGAGAAATACCTACTGTGGTACGATGTTCAGAGACGCTTGGTCACGAT
ATGTCTCAAGGAGAAGGTTAGCCCCGAGGAACAGCTCAAATCATGGGTGC
ACGCCCTTGTCCTGGCTAGGGAGATACGCCACCACTGGCCCAAGGAAGGG
GCCGACAATTCAAACAGGCCATCTCAGCAGGCGTTACTGGATACTGTCAG
GAGATCATTGGACGATATAGGCATGTCCTTCACGCCTATGCTAGGGAGGT
TGAAGGGAGCTGGGTGGGACCTGGATGCGGCAGTGTTGGAGACGGTGCCC
GGCTATCGGGTTAGTATACGCCCTGTAGAGATCACAGGCG

Sequences in the Contig:

SY0AAB29YL19FM1