Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YL14FM1
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00001032001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06484
Accession: ref|XP_001796854.1| Score: 840 E_value: 7e-90
KEGG Definition: G-protein comlpex beta subunit CpcB
Accession: afm:AFUA_4G13170 Score: 830 E_value: 2e-89
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0279 Score: 694 E_value: 5e-74
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 126 E_value: 3e-08
Swissprot: Q01369|GBLP_NEUCR

Sequence:
>SY0AAB29YL14FM1
TTGGGAGACTCAGATCACGTCGAGAACGCTTGCTTAATTACACAAAATGA
CTGAGCAGATGGTTTTGCGCGGAACCCTTGAAGGCCCTTGCTACCTCCCT
CGAGAACCCCAACATGCTCTTGTCTGCTTCGCGCGACAAGACCTTGATCA
TCTGGAATCTCACTCGCGATAGTGATACTGGCTACGGTGTTCCCAAGAGA
AGTCTTAAGGGTCATTCTCACATCGTTTCTGACTGTGTCATCTCTTCCGA
CGGCGCATATGCCCTCTCTGCTTCATGGGACAGGACCCTCCGTCTGTGGG
AACTCTCCACTGGTCAGACCACCCGCCGCTTCGTCGGCCATGATAACGAT
GTCTTGAGTGTTTCCTTCTCTGCCGATAACCGCCAGATCGTGTCTGGGTC
TAGGGACCGTACTATTAAACTCTGGAATACCCTTGGTGACTGCAAGTTTA
CCATCACTGATAAGGGGCACACTGACTGGGTTTCTTGCGTCCGTTTCTCG
CCAAACCCTCAGAACCCGGTGATTGTCTCTGCTGGATGGGATAAGTTGGT
TAAGGTCTGGGAGCTGGCGTCTTGCCGCATTCAAACCGATCATACCGGA

Sequences in the Contig:

SY0AAB29YL14FM1