Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YK14FM1
Length(NT) : 426
Best Gene Model Blast : Link to GSTUMT00008736001 E-value : 1e-176
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04766
Accession: ref|XP_001795177.1| Score: 323 E_value: 9e-29
KEGG Definition: hypothetical protein
Accession: ani:AN1410.2 Score: 302 E_value: 1e-26
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1558 Score: 191 E_value: 5e-16
PFAM Definition: Zip, ZIP Zinc transporter. The ZIP family consists of zinc transport proteins and many putative metal transporters. The main contribution to this family is from the Arabidopsis thaliana ZIP protein family these proteins are responsible for zinc uptake in the plant. Also found within this family are C. elegans proteins of unknown function which are annotated as being similar to human growth arrest inducible gene product, although this protein in not found within this family..
Pfam Number: pfam02535 Score: 160 E_value: 2e-12
Swissprot: P32804|ZRT1_YEAST
Gene Ontology:
GO:0005887 = Cellular component: integral to plasma membrane
GO:0000006 = Molecular function: high affinity zinc uptake transmembrane transporter activity
GO:0006830 = Biological process: high-affinity zinc ion transport

Sequence:
>SY0AAB29YK14FM1
TTGGCGACAACGGTTCCTGGAAACCATGGTTAATGTGCTTGGCATATGGT
ACCACAACTCCCATTGGGCAAGCAATCGGTCTCGCAACCCGGAAGCTATA
TGACCCCGCGTCTCAAACCGGTCTGTTAATGGTCGGAATCATGAATGCAA
TTTCGAGTGGACTACTTTTGTTTGCTGGCCTCGTCGAGTTACTAGCGGAG
GACTTTCTCAGCGATGAGAGTTATGTTGTTCTTACTGGGAAGAGAAGATA
TCAAGCTTGTGGAGCAGTGGCTGCTGGGGGATTCGGCATGGCGCTCATTG
GCGCTTGGGCTTAGATGAATTCCCAATCATAGACGGTACAAAGGAGTTTT
TTTTTGGTCACTTTTTGCATACTTACTCACTTTTTGTATCATATTACCCC
TGAATTATGAACCAGGTTTTTTTTTG

Sequences in the Contig:

SY0AAB29YK14FM1