Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YI05FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00001158001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU01498
Accession: ref|XP_956947.1| Score: 271 E_value: 1e-22
KEGG Definition: related to ser/thr protein kinase IME2 [MIPS]
Accession: ncr:NCU01498.1 Score: 271 E_value: 7e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB29YI05FM1
TTGGATTTCAAATAACGCAGCGCCTATGATGATTCTGCCAACCATTCGCC
CAGTGTCACCACTGAGCGATGCGGTATCTGTTGAGGCAGCAAGGGCGAGG
CGAGAAAATGATTCCCCTTCAATTGAGAGGGAACGGAGGAAAATGGAAGA
GAAGACGGTCAAGAAGTTGGGTCGTCAGTTATCGGTGGCTTCGACGAATT
CTCAAAATAATGGTTATTCTAATCCCCATATAGCGATGGCAGTAGATAAG
TTGAATGGCAACTCTGGAAGTGGTATGGTTAGCCCGACTTCTGCAGGGAC
TCAGAAGGAAGGATTCTTTTCTCATTTACGGAAACGAGCGAGGAGGCTGT
CTGCAAAAAATGGACTTCCTTCGAGTCCTGGCGATGAGGACCTGGAGGCT
GGAATGGGTTGTGGGATAGCGTGGGGTGGAGGAAGGGAAGGGGGAGAGAG
TAACAGGAGTAGTATGTTGGTGGAAAGTCCAAATGGGGGGGAGAGTGGAG
GATTTGATCGGGCGATCAAGGATGTAGATGGTGTATTGGATGATGCAAGT
GGGTTGGTT

Sequences in the Contig:

SY0AAB29YI05FM1