Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YG19FM1
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00008437001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001216382.1| Score: 294 E_value: 5e-25
KEGG Definition: hypothetical protein
Accession: ani:AN1559.2 Score: 293 E_value: 3e-25
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3335 Score: 173 E_value: 1e-13
PFAM Definition: OPA3, Optic atrophy 3 protein (OPA3). This family consists of several optic atrophy 3 (OPA3) proteins. OPA3 deficiency causes type III 3-methylglutaconic aciduria (MGA) in humans. This disease manifests with early bilateral optic atrophy, spasticity, extrapyramidal dysfunction, ataxia, and cognitive deficits, but normal longevity..
Pfam Number: pfam07047 Score: 146 E_value: 2e-10
Swissprot: Q9P7W0|OPA3_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB29YG19FM1
TTGGACCACCCCCGCTTCAGGCGTCTATGCATAAACATAGCGCAGCAAAT
CCACCGCGTAGACATGCGTCTCCGCCTCGGTATCCTGCGGGACTCGGCCG
CCATCGAGAAAGCCGACCAGGCTGAACGCGAATGGTATAAGAAGGAAGCC
GCCAAGCGATCGAAGGAGCGAGAGGCAAAACGCCCCACCGCTACATCAAA
TATACCCCCGAACCTCCCGCTGCCCCCACGCTCGGTTGTGCATCATGTCA
CGGGCGGTGAGGCTGCTGCGGCGAGGGCGGGGAAGGAATTATCCAAGAAG
CCGCCCAGGATTAGACCGCTCAGTGAGAATAAAGCGATTGAGAACGGCGC
AAATTTCATCAGCGAGTTTTTCTTATTTAGCGTTGCTGGAGGTTTGATTC
TCCTCGAGCAGATTCGGTCCAGGAGGAAGGAGGCGAGCCGGAGGGATATG
GTTGCTGATCGGCTAGAGGGGCTCGAGGAGAGGAATTTAGTAGACGAGGA
AAGGTTTAAGAGGCTCGAGGAACAGACAAGAGAGAGCGAAGATAGGGTAT
TGAAGCTCGAGGAGGAGAATTGGAAGTTGAAGGGCGGAAAGGGGAAGTTT
CCTGGGAGAAAAATCAGTGAAGATAAAAGGGTTGCGGAAGAGAAAATGTT
GGCTGAAAGGCCTATCCCCGTCAAGTTTGTCAAAGAG

Sequences in the Contig:

SY0AAB29YG19FM1