Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YF22FM1
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00011854001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_04451
Accession: ref|XP_001557201.1| Score: 824 E_value: 2e-86
KEGG Definition: hypothetical protein [EC:6.3.4.3]; K01938 formate--tetrahydrofolate ligase
Accession: mgr:MGG_01014 Score: 769 E_value: 2e-80
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG4230 Score: 775 E_value: 3e-83
PFAM Definition: THF_DHG_CYH, Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain..
Pfam Number: pfam00763 Score: 399 E_value: 8e-40
Swissprot: P09440|C1TM_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0004329 = Molecular function: formate-tetrahydrofolate ligase activity
GO:0004477 = Molecular function: methenyltetrahydrofolate cyclohydrolase activity
GO:0004488 = Molecular function: methylenetetrahydrofolate dehydrogenase (NADP+) activity
GO:0001718 = Biological process: conversion of met-tRNAf to fmet-tRNA
GO:0046656 = Biological process: folic acid biosynthetic process

Sequence:
>SY0AAB29YF22FM1
TTGGACACCCGTTTACCAGAAATTTCTCAACTACTCAGTTCGAGATGGTT
GCTGAAAGAATCGACGGTACCGCTGTTGCGAGGAAGGTTCGGGATAGAAT
CAATGAAGAGATTAAGAAGAGGCAGAAGACTAATAAGAGGTTTAGACCTT
CCTTGACAATTGTACAAGTTGGTGATAGATCTGATTCATCTACATACGTG
CGCATGAAACTGAAGGCTGCTGAGGAGGCAAACATCACATGCGAAATTGT
CAAACTTCCCGCAGATACCACTGAAGCTGAGCTGTTAGCCAGAATTGAAG
GTCTGAATGACGACCCTTCAATCCACGGTGTCCTGGTTCAATTGCCAGTT
CCAAGGCATATTTCGGAGGCAGCGGTTACCGCTGCTGTTGATCCTTCGAA
AGATGTCGACGGTTTTGGTGCCGTCAACGTCGGTGACCTCGCCAAGCGTG
GTGGAACTCCTATGTTTACTCCCTGCACACCTAAAGGTGTCATGGTTCTT
CTAGAAGAGTATGGAGTAGATCTTTCCGGAAAGCACGCTGTAGTTCTCGG
AAGAAGTGACATCGTTGGCTCTCCAGTATCATACCTCCTGAAAAACTCAG
ATGCAACAGTCACAGTATGCCACTCGGCTACAAAGAATCTGCATGATTTT
GTCAAGCGGGCAGACGTTTTAGTGTCCGCGATCGGAAAAGCACTATTTG

Sequences in the Contig:

SY0AAB29YF22FM1