Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YF11FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00010524001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08837
Accession: ref|XP_001241674.1| Score: 571 E_value: 3e-57
KEGG Definition: RNA polymerase II transcription elongation factor DSIF/SUPT5H/SPT5
Accession: aor:AO090023000710 Score: 558 E_value: 5e-56
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1999 Score: 446 E_value: 3e-45
PFAM Definition: No Hit Found
Swissprot: Q2UGU3|SPT5_ASPOR

Sequence:
>SY0AAB29YF11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTTGGGGCGTCAAGTGTAAGCCTGGAAAGGAGAGGGAAATTG
TTTTTTCGATTCTTAGGAAGCAGGAGGAATTAGCCAACACGAAGGCTCCT
CTACAGATCACCTCTGCACTCGAACGCGGTAATACTATGCCCGGGTATAT
CTACGTCGAAGCAAAGAAGCAAGCGGACGTTATGCATGCCCTTCAAGGTG
TCTCTTTTGTCTATCCCATGACGAAGATGATTCTTGTCCCTATTAAGGAG
ATGCCAGACCTTCTTTTTGTTATGAAGAAAGCCGAGATCACACCAGGGAC
ATGGGTTCGTTTTAAACGTGGAAAATACCAAGGCGATCTTGCTCAGGTTG
AAAACGTCTTAGCTAGTGGCCTCGAGGTCAAGATTAGGATGGTACCTAGG
TTGGACTACGGCAACGGGGCTGATGCAGACGACCCGAGCGGTAACAAGCG
AAAGCGCAACCCTTTCGGAAAGAATGGGTCACTTGCCGGACGCCCCCCAC
AGCGACTATTCTCCGAAGTTGAAGCCAGAAAGAACCACGCAAAGTATTTG
TCACAGGCGGCACAGGGATTGAAGAAGATTTTCACCTATCTCG

Sequences in the Contig:

SY0AAB29YF11FM1