Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YF10FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00005181001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10721
Accession: ref|XP_001550836.1| Score: 722 E_value: 1e-74
KEGG Definition: BET3 family protein
Accession: afm:AFUA_6G05220 Score: 668 E_value: 1e-68
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3316 Score: 460 E_value: 7e-47
PFAM Definition: TRAPP_Bet3, Transport protein particle (TRAPP) component, Bet3. TRAPP plays a key role in the targeting and/or fusion of ER-to-Golgi transport vesicles with their acceptor compartment. TRAPP is a large multimeric protein that contains at least 10 subunits. The Bet3 subunit has a dimeric structure with hydrophobic channels. The channel entrances are located on a putative membrane-interacting surface that is distinctively flat, wide and decorated with positively charged residues. Bet3 is proposed to localise TRAPP to the Golgi..
Pfam Number: pfam04051 Score: 305 E_value: 7e-29
Swissprot: Q86SZ2|TPC6B_HUMAN

Sequence:
>SY0AAB29YF10FM1
TTGGCTCCCAGCTTACCGCAGAACGAAAAACAACGACAACAACACGAGAC
AACAACAGCGACAATTTACCGGTATGTCCTTCGAACCCCCACTCCCCCCC
TTCAACGCCTCGGATCCGCACGCCACCTTCCTGAGCTCCACATGCCTGGA
CCTGCTCCTGATCGAGCTAGTCCCGCTCGCGCACCGACTCTCCCAACAGC
TGGCGGAGACGCCGCACGACTCGCTGCATGGCGACGACGACGAGGACGAG
GTGCGCGAAGCCGTCTTCTACCGCCTGGAGATGCTGGGGTACCGGGTGGG
GTACGGGCTCGTGGAGCGCTTCTCGCGCGATAGGCCGCGCATGAACGATA
CGCTTGACGTCATCAAGTTCGTGTGTAAGGACCTTTGGACCATTGTCTTT
AGGAAGCAGATTGATAACCTGAAGACTAATCATCGGGGGGTTTACGTACT
CACGGACAATTCTTTCAAGCCCTTCTCCAGGATGAGTGCGGAGACAGGGG
GGAATGCGGTTGCTATGGCTCAGCCATTTCTCTGGTTTCCATGTGGGATA
GTTAGGGGTGCTTTGGCAAATATGGGGGTTAATGCGAGTGTCCAGGCAGA
GACGACGGAGCTGCCAGCTGCTACTTTCAAGATAGAGACTTTGTCGAAGC
CTGTGGC

Sequences in the Contig:

SY0AAB29YF10FM1