Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YF09FM1
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00004513001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: replication fork protection component Swi3, putative
Accession: ref|XP_001262324.1| Score: 350 E_value: 1e-31
KEGG Definition: replication fork protection component Swi3, putative
Accession: afm:AFUA_4G04745 Score: 339 E_value: 1e-30
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG3004 Score: 209 E_value: 8e-18
PFAM Definition: Swi3, Replication Fork Protection Component Swi3. Replication fork pausing is required to initiate a recombination events. More specifically, Swi1 is required for recombination near the mat1 locus. Swi3 has been found to co-purify with Swi1 Swi3, together with Swi1, define a fork protection complex that coordinates leading- and lagging-strand synthesis and stabilises stalled replication forks. The Swi1-Swi3 complex is required for accurate replication, fork protection and replication checkpoint signalling.
Pfam Number: pfam07962 Score: 227 E_value: 7e-20
Swissprot: A1D9E6|CSM3_NEOFI

Sequence:
>SY0AAB29YF09FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCGCGTTCCCAATACTTT
CATGAATTTTATAACGAACAAACAAACAACACTGCGCAACATGCCGGGAG
ACTCTTCTAACACTGCGGGTGAGAACTACATGGATGACGATTTGTTCGAA
TATGATGCGGATATTCCGGATATCGACACGACTATCAGACAGCCCACCCC
TGAGAAGAAGGATGGGACCAAGGACAATCTAGGACTTGAGGAAGAAGTCA
AGATCAGGAAAAAGCGGATCAATGTCAAACTGGATGAGGCAAGGCTCTTG
AGAGAAGACATTGGGATTCCCAAACTCAGAAGGGAGGCTCACAAGAAACT
CAGGTTCAAGGGGAAAGGCTATGAATACCGAGATGCCGCGAGACTACTTT
CCTACTACCAACTCTGGGCCGACGACCTCTACAAAAAAGCCAAATTCCGA
GATACCCTTCAGATCATCGAGAAGCTCGGTCACTCTCGGAGAATGAAAAT
GGAGAGGGAAGCCTGGGTTATGGATAGTAAGAAAAAGACAAGTGGCGATA
CAGAAGAAAAGAGTTTGGATCAAGGCTTGGATGAAGGGAGGCCAGGAACC
AGCACTACA

Sequences in the Contig:

SY0AAB29YF09FM1