Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YE18FM1
Length(NT) : 709
Best Gene Model Blast : Link to GSTUMT00007470001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN5011.2
Accession: ref|XP_662615.1| Score: 1026 E_value: 1e-110
KEGG Definition: hypothetical protein
Accession: ani:AN5011.2 Score: 1026 E_value: 1e-110
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P25618|CWH43_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005934 = Cellular component: cellular bud tip
GO:0005887 = Cellular component: integral to plasma membrane
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006506 = Biological process: GPI anchor biosynthetic process
GO:0007165 = Biological process: signal transduction

Sequence:
>SY0AAB29YE18FM1
TTGGAGCCGAAGACGCTTCAGATCATACGCCGTCTATTCTCTCGTTGGTC
TGGAGCTTTTCGCAGCCTCGATCGCATACATGCGTTTCCCATCCTTCGAC
TACCAGCCATACCACAAAGAAGAAAAGGTTCTGACCGCCGGCATATGGAC
TGTCCACTTTGCGCTCGACAATGATATGTGGAGTAGCGAGAGGCGTATAA
GAGACGTTATCAAGGATTTGGAGGTCGACGTCATTGGTCTCCTTGAATCG
GACCTGCAAAGGATTATCATGGGCAACCGCGACATGACACAATTCCTTGC
GGAAGATCTTGGAATGTATGCAGACTTTGGCCCTGGGCCAAACAAGCACA
CATGGGGAGCTGCGCTTCTCTCCAAATTCCCCATTGTCAACTCCACACAT
CACCTCCTTCCCTCACCGGTGGGCGAGCTCGCGCCCGCTATCCTCGCAAC
ACTTGACATGTACGGAGAGATGGTAGACGTCCTAGTCTTCCACAGCGGAC
AGGAGGAGGATGTGTTGGACAGGAAATTGCAGAGTGAGGGTATCGCAAAG
CTTATGGGCGACAGTCCAAGGCCGTTGATCCTACTAAGCTATCTCGTCAC
AAAGCCCAAACAGGGCAATTACAACACATACGTCAGCGAGACAAGCAGAA
TGAGGGACATCGACAGCAGTGATTGGGATAGATGGTGCGAATACATCCTA
TATAGGGGA

Sequences in the Contig:

SY0AAB29YE18FM1