Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YE04FM1
Length(NT) : 450
Best Gene Model Blast : Link to GSTUMT00010433001 E-value : 7e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15785
Accession: ref|XP_001805923.1| Score: 148 E_value: 2e-08
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB29YE04FM1
TTGGGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAA
GCAGGCATATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGC
GGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAG
TCGGGGGCATCAGTATTCAATTGTCAGAGGTCTCGTTCCATGATTTTTTC
TAGAAGCGATGGTGCTGTCAGTATTCAGAGGTAGTGGTCACGGAACCGGT
TCTTACCAATCTGTGCGAGTGTGTGGGGTTTCGTAAGGTGCTTTTGGTAT
ATTATATTCAGTCGTTCTCTAACTCGGAGAATTTCCTTCGCGTGGATCGC
GATATCACTATTCCCCTTAGTCATCAGTCTTCTTTCAATGCCATAGAATG
GAAGAGAAAAAGAGAAGAAAAATAATAATAAGAATAATTCAATTCCTCTC

Sequences in the Contig:

SY0AAB29YE04FM1