Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YD15FM1
Length(NT) : 682
Best Gene Model Blast : Link to GSTUMT00010746001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: putative 3-phosphoserine phosphatase
Accession: gb|AAM03453.1| Score: 562 E_value: 4e-56
KEGG Definition: hypothetical protein
Accession: fgr:FG09658.1 Score: 401 E_value: 9e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53981|YNB0_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB29YD15FM1
TTGGCTTTTTTTGCTACCCTTAAACTATTATACCATAAACTATAGACGGA
TAAATTTTCTGTTCAATCAAACATGGCCCCCGCAAACAAAGCTGTTGTCT
TTACCGATTTCGATGGAACCATTACTCTGAAAGACAGTACGTAGCCAGTT
GAGAGTGAATTGATCTCTCGTGGAAGCCTACAATTAACTAACATCGGTTA
TCCTCGACTGCCAGGTAATGATTACTTGGTCAGTTCCCCATCTCTCTCAC
TCGTGCTGCCAACAGTCCCCGGGCCCTTGCTGACGTCTTCAAATATAGAC
CGACAACCTTGGATATGGGGAGCAGAAGCGTAGAGATGGCAACATTGATA
TCCTCGAGAACCGTGTCAAGTTTCGCGATGCATTCAAGGAAATGCTCGAC
TCAGTACCCACCCCCTTCGACGAGTGTGTTGATATCCTCGTCAAGAACAT
CAAGCTGGACCCGGGCTTCAAGGATTTCTACGCCTGGTGCTTGGCTGAGG
GGATTCCCGTCATCGTTCTTTCATCCGGAATGGAGCCCATTATTCGCGCG
CTCTTGACCAATCTTGTTGGACCAACAGCAGATCAGATTAAGATTGTTAG
CAATCAGCCCAAGCATTTGCCCGATGGGACATGGACCATCGATTATCATG
ATGACAGCGACTTTGGACACGATAAATCGTTG

Sequences in the Contig:

SY0AAB29YD15FM1