Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YD04FM1
Length(NT) : 356
Best Gene Model Blast : Link to GSTUMT00011659001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g00860
Accession: ref|XP_001394094.1| Score: 253 E_value: 1e-20
KEGG Definition: hypothetical protein
Accession: ang:An11g00860 Score: 253 E_value: 5e-21
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1824 Score: 131 E_value: 3e-09
PFAM Definition: No Hit Found

Sequence:
>SY0AAB29YD04FM1
GATGAATGGTCTCTTGCAAGATGTTGGAGTAAATGGGGAGACTAGCATTG
TGGCCAAGGTTGTTGCGCAATTACTTGTTAGTGGTGGTGGAAAACGAGGC
GGATTTGCCATAGGTGTTGAGGAGTTCGTGGGTGAAGTGGTTAAAACTAC
GGATGATAAGAGAAAATGTTTGGCGTTAATGGTGCTTGGAGAGATTGGTC
TCAGAATGGGCCCTTCATTCTCTGTTGGACCGGAAACTTTTCTTCAGCAA
TTCCATGCAAAGAGCGATGATGTTCCGATCGCGGCTGCCGTAGCCTTGGG
CCTTGCTAGTGCTGGGAATGTTCAAGGCTATTTACCTGTGATTATGCAGA
GGCTCG

Sequences in the Contig:

SY0AAB29YD04FM1