Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB29YC05FM1
Length(NT) : 493
Best Gene Model Blast : Link to GSTUMT00004263001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_08698
Accession: ref|XP_001552220.1| Score: 579 E_value: 2e-58
KEGG Definition: hypothetical protein
Accession: ani:AN0502.2 Score: 526 E_value: 1e-52
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1160 Score: 395 E_value: 1e-39
PFAM Definition: Wyosine_form, Wyosine base formation. Some proteins in this family appear to be important in wyosine base formation in a subset of phenylalanine specific tRNAs. It has been proposed that they participates in converting tRNA(Phe)-m(1)G(37) to tRNA(Phe)-yW..
Pfam Number: pfam08608 Score: 210 E_value: 4e-18
Swissprot: Q08960|TYW1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0031591 = Biological process: wybutosine biosynthetic process

Sequence:
>SY0AAB29YC05FM1
TTGGAGGGACTCCCCTGCTTTGTCGAAGTCAAAGGAGTGACGTACTGTGG
AACATCGACAGCTGGAGAAGCAGGCCTAACTATGAAGAACGTACCCTTTT
ACGAGGAAGTCGTAACTTTCGTCGAAGCGCTTAACGCAGAACTTGCCAGG
CGTGGGCTGGGGTATGGTATCGCCGCCGAGCATTCTCACAGCTGTTGCGC
CCTGATCGCCTCAAACCGCTTCTTTATCAACGGGAAATGGCACACACTAA
TTGACTACGCCAAGTTCTTTGAGCTGCTTGAGAGTGGGAGGGAGTTTGGC
CCAGAGGATTATATTGGAGAGGCTACTCCGGAGTGGGCCAATTGGGGGAA
TGGGGGATTTGATCCGGCGGATCAGAGGGTTTATAGGAAAGGGAAGGGGC
CCAAGGAGGAGGTTGAGGAAAGTGGCGGGTGTGGGTAGTGTATCATAATA
TTATGATAGTGGGGGGGTAGATGTACAGATACTGGTTTCTGGC

Sequences in the Contig:

SY0AAB29YC05FM1