Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YO12FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00004528001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03455
Accession: ref|XP_001244014.1| Score: 341 E_value: 2e-30
KEGG Definition: hypothetical protein
Accession: ang:An02g08840 Score: 316 E_value: 6e-28
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0247 Score: 152 E_value: 3e-11
PFAM Definition: No Hit Found

Sequence:
>SY0AAB28YO12FM1
TTGGGTGGTTCCATGGCGCCAGTCGAAGCTCACTGAGTTGTTATTCTCCA
ATTCATTTTCGGGCGCTGGGGGTGGGGGGCAGAGGGCCAGCATGATAGTC
ACCGCGGACGCCATGGGTGACTTCAACGCTACGACGCAGATACTGCGCTA
CTCCGCGCTGGCCAGAGAAGTGACAGTCCCCCGGGCATCCAGCCGACAGA
TCTCCGGAATGTCCGACTCCAGCGCCGCTTCCTCCACTCTGGACGAACTA
GCAGCAATCCCAACCTCCGTCACCCAAGACGACAGCAAAGACATCCTGAT
AGCGCGCCTAATAGCGCAGTTGGAAGAGACTGAAGCCCGCTGGCGCGACG
CCGAGGAACGCTGCCTATCAACCGAGCAGCAAGTGCGCGAAGAGGTAGCA
GACGAGATGGAAGAGCGCCTGGAAGAAGTCCGCCGGGAGACACTAGAGCA
CTATGAGATGGAAGAGGAGTGGCGGGAAGGCTACGTCGATGGGAAGCTGG
AGATTCTGCGTAAGGGCATCAAAATTCGCGAAGACACACCCCCGGGCGCA
GCCGAGCGGATACGGGAACTCGAGGGTGAGAATGAGGCGCTGAGGAGGGA
GTCGTTAGTGCTTAGACGGGAGGCGCTGGGGAGGAGTCCTTCCAAG

Sequences in the Contig:

SY0AAB28YO12FM1