Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YN24FM1
Length(NT) : 502
Best Gene Model Blast : Link to GSTUMT00008926001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: Mannosyltransferase of the KTR1 family, involved in protein N-glycosylation; located in the Golgi apparatus; Yur1p
Accession: ref|NP_012396.1| Score: 184 E_value: 2e-26
KEGG Definition: YUR1; Mannosyltransferase of the KTR1 family, involved in protein N-glycosylation; located in the Golgi apparatus [EC:2.4.1.-]; K03854 mannosyltransferase
Accession: sce:YJL139C Score: 184 E_value: 9e-27
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4472 Score: 226 E_value: 7e-20
PFAM Definition: Glyco_transf_15, Glycolipid 2-alpha-mannosyltransferase. This is a family of alpha-1,2 mannosyl-transferases involved in N-linked and O-linked glycosylation of proteins. Some of the enzymes in this family have been shown to be involved in O- and N-linked glycan modifications in the Golgi..
Pfam Number: pfam01793 Score: 238 E_value: 2e-21
Swissprot: P26725|YUR1_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0000030 = Molecular function: mannosyltransferase activity
GO:0000032 = Biological process: cell wall mannoprotein biosynthetic process
GO:0006487 = Biological process: protein amino acid N-linked glycosylation

Sequence:
>SY0AAB28YN24FM1
TTGGGGCATACGGGTCAGCCTCAACATGGGACAGATACAGCTGAACTGGA
GGATGGCCCCCCGAGCGCAACCTGTTTCGGCGCCGAGCTCGGGCATAATG
GAACCGAGAAGGCGACCCTGGTTATGCTCGTAAGGAATAGTGAGCTCCAC
GGGGCCTTGTCTTCTATCAGGATGGTCGAGGATAGGTTCAATAGACGATT
CCACTATCCGTGGACTTTCCTTAACGACAAGCCATTCACCGACGACGTAA
GTGAAATTCTGACCCGAGGAGGCTCTCGCTCGCTCATCCCGATTGGCCTG
GTTTCTGATATCACGGTAGTTCATCAAGTACACTTCCGGACTCGCCAGTG
GCCCGGTTGAATACGCCGTCATCCCGGAGGATGATTGGTCCATTCCCGAC
CATGTAAACACGACAATTATGAGAGCAGAAATGTTGCGGATGGCAAAACA
GGAGATCATCTATGGCGGTTCCTTATCTTACCGACACATGTGCCGATTTA
AC

Sequences in the Contig:

SY0AAB28YN24FM1