Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YN14FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00008697001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04371
Accession: ref|XP_361926.1| Score: 318 E_value: 8e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04371 Score: 318 E_value: 4e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O14091|SUT1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005887 = Cellular component: integral to plasma membrane
GO:0005774 = Cellular component: vacuolar membrane
GO:0015151 = Molecular function: alpha-glucoside transmembrane transporter activity
GO:0015768 = Biological process: maltose transport
GO:0015770 = Biological process: sucrose transport

Sequence:
>SY0AAB28YN14FM1
TTGGCACATGGATATTTGGTCATATTATCTACGCATTTCTCATGCTTACA
ACAATATTCATTGGGACGGTGGGCTCTGCGACATTCTGTGTCGCGCTCAG
CGGAGGGTCTTGGGCGTTAATGACATGGGCACCTTTTAGTATCGTGGGTG
AAGAAATCAACAAGCTCTGTGAGTCTTCCGGAACGGTACATCGGCCTCGC
AGTGGCCCCTACGACCCTGTTGCACAAAATGAGCTTGATCATGATGTGCA
AGAAATGGAAATGATCAGAGCCTCGATATCTGCTGATGCCGCCCCAATAG
TCGCTGATCCAGAGGTCCAGTCACACGAGTCGAGCGATCTTGCAGGTGTA
TATCTCGGAATCATGAATGTGTTTTCATGTCTTCCCCAATTCGTGGGCTC
TTTCATATCCTTCGCTGTATTCTCCATTCTTGAGCCAGGAAAAAGTCCTG
AGTTTTCCGAAGGAGGAAGCTCTGAAGCACCGACCTATAGGGTAAACGCC
ATTGCAGTCTGTATGGGCATTGGAGGAATCGCCACTCTAGTGGCGGCACA
CTTCACTACGAGGTTTAGGTATCGTTGAGTTGAGGTGCCTATTACTGGCA
TCGGGACGAATGTACTGTACATTACTCTTTGTTTCTCTGGGCGAGGTTGT
GGGAAGTATGTTGCAACAAA

Sequences in the Contig:

SY0AAB28YN14FM1