Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YK12FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00011120001 E-value : 1e-114
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_01849
Accession: ref|XP_001221070.1| Score: 132 E_value: 2e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG00410.1 Score: 129 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB28YK12FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAGCGTTGAAGGAGGAGTG
GGACTCGCGCAGGCGGAACACACCTAGTCGGAGTGCTAGCGCGGACAAGC
GCAAAAGGTGGAGCGTGTGCGGAGCGGAGAAGAGGAGCGACCTGGAGCTG
GAGACGATATGGGAAGAGGCCAGCTTCGGCGTGGAGATTGTGGGTAGGGG
CTCTTGTGATGGGATGGGTGAAGGGGAGATGATTTGATTTCAACCCCCTC
TTTTTTTCTTTTTTTTTTCCCCCCCTTCTTTCTTTCTTATTTTTTGGCTT
TATTGTTTGGGAGCGAGCAAGCGGGGAAGTTGGAATAATGGCGTTGTAAT
TTTCATCTTTCGGGCACTCTATACCCCCCTCCCCCACTCATCATCAACAT
TCACATCACTTGTGTTCTTACCCCCTCCCTTGCATACAGACATAAGCATC
ATACCAAATCCTTTTCATTGTCATCATTTCTTTTTGTCACCTTTTTACTA
CTACTACTTTAATCCTAGGTGAATGAAGGACGAAGCGATGGGCATTTATA
GAATGGAAAAAAAAACAATGGAAATGAAGGTCATGTATTTTT

Sequences in the Contig:

SY0AAB28YK12FM1