Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YK11FM1
Length(NT) : 637
Best Gene Model Blast : Link to GSTUMT00004430001 E-value : 1e-128
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001555077.1| Score: 268 E_value: 4e-22
KEGG Definition: hypothetical protein
Accession: ang:An16g04580 Score: 265 E_value: 5e-22
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis, Transcription].
Kog Number: KOG3677 Score: 149 E_value: 8e-11
PFAM Definition: No Hit Found
Swissprot: Q8QZY1|IF3EI_MOUSE
Gene Ontology:
GO:0001650 = Cellular component: fibrillar center
GO:0005654 = Cellular component: nucleoplasm
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB28YK11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCTGGTCGAAGAGGCACT
TCGAGATGACGGCGACTACGATGACCTGGAATCGGCGGGCGGGAGTCTCC
AAATATCTGGCGAGAATATCCAACAGCGATTAGCTGCAGCAGCTACCCCA
CTAGACTTTCAAGCCCCCCTACAAAATCGATTTGACAGCTACGACAATTA
CTGCACGCTTTTTCACTTTATCCTCAATTCGGATGGGCCAGTGGATCTAG
AACTACCGACTGTAGGTTCATTTTCACATTACGTTGATACTCCTATGGGA
CAAGTGGACGCAACAACGGTAGCATCCTGCAGATCGAATGCTTTTGTTTT
ATTTCTATGCCTCCCGGTGGGGGATATGATTAAGGATGACCGAGCTAATG
ATAATTTACTGTTAGTACTATTGGGCTTGGGATGTTATCGATGAGTTTAT
CTATCAGTTTAACAGCTTCTGCAGCCATCGCAATGCCGTGGCTCGAAAGG
AGGGCGGTGGTAGTGAGGAGGAGAGAAGGCTGTTGTGTGATCACCCACAA
ACTTGGGGGTGTTACAGTGTACTTAACGTTCTCTACTCTTTGATCCAGCG
TTCTCAGATGAATGAGCAACTCGCCGCCATTAAGAAG

Sequences in the Contig:

SY0AAB28YK11FM1