Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YK10FM1
Length(NT) : 449
Best Gene Model Blast : Link to GSTUMT00007523001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR10011.1| Score: 383 E_value: 9e-36
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G06510 Score: 372 E_value: 8e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB28YK10FM1
GACATAGTCCCCGACACCGACAACGTCGAGAAACTGATCTCGCGCGTGCT
GTCAGAGTACATCGACGCGGCGTGCACGCCGCCGCCGGAGTGGACGGGAG
CGGGGAGTAGGAACGATGCGTGTGAGATTTGCGAGAGGGTCGGAGTGGGG
ATTACGTATCATCATTTGATTCCGAAATCTACGCACGCAAAAGTAATCAA
GAGGAAGTGGCATCCGGAGGTTATGCTTGATAGCGTTGCATGGCTTTGTC
GACCGTGTCATTCGACTGTTCATCGTTGCGCTTCCAATGAAGTTCTTGCC
CGGGAGTATTATACCGTTGCCCTGTTGCTTGAGAGGGAGGATATACAGAG
GGGGCTTAAGAATCGGTAGGATGGTTGGTGGTGGTACTGTACAATACCGG
GACAAAAGCGATCGTCACTTGCTCTTTTCACACCAAAAGTGGCTGTTCT

Sequences in the Contig:

SY0AAB28YK10FM1