Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YI20FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00005810001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001271065.1| Score: 175 E_value: 3e-11
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_3G10610 Score: 169 E_value: 6e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB28YI20FM1
TTGGAGACCCTCGAGGTCAACAGTCCCCTCTATCCCACCTCGCCCGAGTT
CAAAGCCACGCTCAAAATCACCTCTTGAGCAAGAGGGACCTGCGCTGACT
ACTATTCCACCCACCACTGAGCTTCACGCCCCTGTCGCAAGGCCGCCAGC
ACCAAAGCCAACGGAGTCCGGCTCAGGCATAACTACGAGCATCACTTTGA
AGAACGATTCGGGAATCCCGCAAATTGGAAGGAGAGTACCTATGTATCCC
AATGCAGGAGATGTACAGGCTCCCAGCCCGGCCGTGACGCCAGGTGCGGG
GAGGAGAAGTCATGTTTATAGAGAGGAGTGGGAGATGGATGAGGGAGCCT
ATGGGCATGGGACACCGAAGGGGATTAATCCGTATACCAGGAGCTCCACC
GATCTCAACCAGTCGGTTGCGCAGAGTCCTGATTTAGGTGATGCCAACGA
TGCATCTACTCCAGTTCCCGACGAAGAAATTGGCTATCTAGCCAGCGAGC
AGTATGCTCGCGTTATCTCGCCGCAGCTAACGGGTACCTCCGCCACTGGG
CATTCGCCCACCTTACGTCGCAGAGATTCGGAAGATGCCCCCGTATCGTT
GTACGGCATTGTCACAAATTCTTCTACC

Sequences in the Contig:

SY0AAB28YI20FM1