Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YD14FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00003049001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: methylenetetrahydrofolate dehydrogenase
Accession: ref|XP_001213946.1| Score: 449 E_value: 3e-43
KEGG Definition: hypothetical protein [EC:1.5.1.15]; K00295 methylenetetrahydrofolate dehydrogenase (NAD+)
Accession: ani:AN1524.2 Score: 433 E_value: 1e-41
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG0089 Score: 269 E_value: 8e-25
PFAM Definition: THF_DHG_CYH, Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain..
Pfam Number: pfam00763 Score: 188 E_value: 2e-15
Swissprot: Q9P786|MTD1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB28YD14FM1
TTGGCTCTGTTCCCTCCCCGCTACTCACCCGAACAACAGGGCTCTTTTAA
AGAGGCAGCACACAATGTCCACAATAGTAGAGGACCCTGCGCCCCCTACT
TGCAAAGTCGTCTACGCCTCCGCCGTGGCCGAGGGCATACTGGGAGAAGT
CAAGGACTCAATCGAGAGGCTGGGGCGGGCGCCATTGTTGGTTGGGTTTC
TGGCGAATGTAGATCCCGCGGCGAGGATGTATGCTAGCTGGACGGGGAAG
ACTTGTTTGCAGAAGTTTGTGGGCTCTTTATTTGTTTTTCATTTTTCGTG
GGTGCTAATGTGCTGTAGTGGGGTAAGGTTTGAGCTTAGGGAGGTGGGTA
AGGATGATCTTGAGGAGAACATTATCGCGGCGAATGCGGATGATGAGGTT
GGGGGGATTATTGTTTATTATCCGGTTTTTGGGAGTAGTCAGGATGCATA
CCTCCAACAGATCACCTCCAAAGAGAAAGATGTTGAGGGCCTCTCGCACG
CTTACTTGTTCAACATGTACCAGAACATCCGCTTCCTCGACCCAGAAAAG
TCGCAAAAG

Sequences in the Contig:

SY0AAB28YD14FM1