Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB28YA15FM1
Length(NT) : 625
Best Gene Model Blast : Link to GSTUMT00001206001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ribosomal L10 protein
Accession: gb|AAO47090.1| Score: 556 E_value: 4e-89
KEGG Definition: hypothetical protein; K02866 large subunit ribosomal protein L10e
Accession: mgr:MGG_03136 Score: 552 E_value: 6e-89
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0857 Score: 446 E_value: 3e-45
PFAM Definition: Ribosomal_L16, Ribosomal protein L16p/L10e..
Pfam Number: pfam00252 Score: 200 E_value: 1e-16
Swissprot: Q09127|RL10A_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB28YA15FM1
TTGGCCCATATCACCAAATCTACACCTTCTCACTTCTCCACACAGATATT
CAGGAAAGATGGCCCGTAGACCCGCTCGCTGCTACCGCTACTGCAAGAAC
AAACCCTACCCCAAGTCACGCTTCAACCGTGGTGTTCCCGACCCCAAGAT
TCGTATCTTCGATTTGGGACGCAAGCGTGCCGGTGTTGACGAATTCCCCC
TTTGCGTCCACTTGGTTTCTAACGAGTACGAACAACTTTCTTCTGAGGTA
TGAATTGTTCCTCGTCCAGTGATGATGTTAGAGGGCCCTCGAAGCTGCCC
GTATTTGCGCCAACAAGTATCTTGTCAAAATTGCTGGAAAGGATGGTTTC
CACATGAGAGTCCGTGCTCACCCCTTCCACGTTATTCGTATCAACAAGAT
GTTGTCTTGTGCTGGAGCCGATAGACTTCAAACTGGTATGCGTGGTGCTT
GGGGTAAGCCTAACGGAACTGTCGCCCGTGTCAACATTGGTCAAATCATT
CTGTCCGTGAGGACACGTGATACACACCGTGCGACCGCTATCGAGGCTCT
GAGGAGGTCCCAATATAAGTTCCCCGGTCGCCAAAAGATCATTGTCTCTA
AGAACTGGGGCTTCACACCCCTTCG

Sequences in the Contig:

SY0AAB28YA15FM1