Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YO24FM1
Length(NT) : 355
Best Gene Model Blast : Link to GSTUMT00004133001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 262 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: ani:AN8541.2 Score: 216 E_value: 1e-16
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 151 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: Q05090|KLC_STRPU

Sequence:
>SY0AAB27YO24FM1
GCGATGATGGGTACGGAGAGGACGCTTGGGCTGGACCACCGGGATACCCT
AATGTGTATCTATAACCTGGCTGGAGCGTTGCACAAACAGAGAAAGTATG
ACGAGGCGGAGATGGTGCATCGGCGTGCGCTTGCGGGACGAGAGAAGATT
CTTGGGTTAGGTCATCGACACACCCTTCGTAGCCTCATCAAGCTAGGCAC
AGTACTTTACGAGAAGAGAGAATACGATGAAGCGGAGGTTATTTATCGAC
GAGCCGTCGCGGAAGCAGAGAGAATTCTAGGGCCTGGTCATCCTGTGACC
CAAAAAGCTTTTAGCCACCTCTCGATGTTTCTCTATATACGGGCGGCGAT
CGATC

Sequences in the Contig:

SY0AAB27YO24FM1