Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YN11FM1
Length(NT) : 732
Best Gene Model Blast : Link to GSTUMT00005636001 E-value : 8e-34
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_05884
Accession: ref|XP_001538279.1| Score: 576 E_value: 2e-78
KEGG Definition: hypothetical protein
Accession: ang:An11g02040 Score: 566 E_value: 4e-78
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2653 Score: 637 E_value: 3e-67
PFAM Definition: NAD_binding_2, NAD binding domain of 6-phosphogluconate dehydrogenase. The NAD binding domain of 6-phosphogluconate dehydrogenase adopts a Rossman fold..
Pfam Number: pfam03446 Score: 337 E_value: 2e-32
Swissprot: O13287|6PGD_CANAL

Sequence:
>SY0AAB27YN11FM1
TTGGTCTACATTCCGGCAGCCTTATGATTTGGCTATTATGTCATATCCCT
GGGCTATGGGAAACCCCTCACTCTTACCCCCGATAATGTCTTTCGTTTGT
TCGGATTTTGAGTTGATGTTTGAATTTTTGCTGACATAGTGAGCGACTGT
CCGCTATTGCTGGCGGCTTCGCATCTTCGACACCCAGCGCTGATTTCGGC
CTTATTGGTCTTGCTGTTATGGGTCAGAACTTGATCCTCAACATTGCAGA
CCATGGCTTTACTGTTGCTGCTTTCAATAGAACCGTATCGAAGGTCGACC
ACTTCTTGGAGAATGAGGCCAAGGGACTTGTGCGACAAGTTGAAGAGTCC
TCGTAGAATAATGTTGCTGGTTAAGGCTGGCCCTGCTGTCGACGACTTCA
TTGCTGCTCTCTTGCCCTTCCTTTCAGCCGGCGATATTATCATTGATGGT
GGTAACTCTCACTTCCCCGACAGCAACCGCCGCGCCAAGTATCTCGCCGA
GAAGCAGATCCGTTTCGTCGGTGCTGGTGTGTCCGGTGGTGAAGAGGGAG
CCCGATATGGCCCTTCCATCATGCCTGGTGGTAATGAGGAGGCATGGCCA
TACATTAAGGATATTTTCCAAAGCATTTCCGCCAAGTCCGATGGCGAGCC
ATGCTGCGATTGGGTTGGTGACGAGGGAGCTGGCCACTTCGTTAAGATGG
TTCACAACGGTATCGAGTATGGTGACATGCAG

Sequences in the Contig:

SY0AAB27YN11FM1