Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YL15FM1
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00010648001 E-value : 1e-143
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01248.1
Accession: ref|XP_381424.1| Score: 783 E_value: 1e-81
KEGG Definition: hypothetical protein
Accession: fgr:FG01248.1 Score: 783 E_value: 5e-82
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1637 Score: 768 E_value: 2e-82
PFAM Definition: HGTP_anticodon, Anticodon binding domain. This domain is found in histidyl, glycyl, threonyl and prolyl tRNA synthetases it is probably the anticodon binding domain..
Pfam Number: pfam03129 Score: 110 E_value: 3e-06
Swissprot: P87144|SYTC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB27YL15FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGACGGACTCTTCGATTTCCT
TAAGACCGTCTATGGACTTTTAGGCTTTACCTTCAAACTCAAGCTTTCTA
CCCGCCCAGAGAAATTCGTCGGTGACATTGCAACCTGGGATTCTGCCGAG
GCTCAATTGACCAAAGCCCTTGACGAATTCACCGCCGGCGGTGGTGGAAA
GTGGGAAATGAACCCAGGAGACGGTGCCTTCTACGGTCCCAAAATCGACA
TCACAATCTCGGACGCCCTCCGCCGCGAACACCAGTGTGCTACTATCCAG
CTCGACTTCCAACTCCCCCAGCGCTTCAAGCTAGAGTACAACACCGGTGA
GCCCTCGGCGAAGGCTCAGGACGGAAAGGATGAGATGGGGCACTACAAAC
GCCCCGTCATGATCCATCGAGCTATCCTGGGAAGTGTGGAGCGCTTCATC
GCGATCCTTACAGAGCACTTTGGCGGGAAGTGGCCGTTCTGGCTCAGCCC
CCGGCAGATCTTGGTCATTCCGGTAATGGCCGCCGCGAATAACTACGTGC
TTGAGATTCAGAAGCTGTTTAGAGCGAAGATGATGCATGTCGATGTTGAT
ATCGGGCCGAATACTATGGCGAAGAAGATTAGGACTGGACAGTTACAACA
GTACAACTTTATCTTTGTCGTTGGAGCC

Sequences in the Contig:

SY0AAB27YL15FM1