Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YL06FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00000030001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_00955
Accession: ref|XP_001220176.1| Score: 136 E_value: 6e-07
KEGG Definition: hypothetical protein
Accession: ncr:NCU09226.1 Score: 132 E_value: 9e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB27YL06FM1
TTGGGAGCGACAGTAATACTGAGAGTAAGGGTGATTGGGACGAAGATGAG
AAGAAAGTCGATGTCGGTGGCGGGAAGTACCTTGTCCCTGTTAGTCTCGA
GAACGATGGCGACTTAGAACAGGATTGGATGAAGAGGGAGTTGGTGGAGT
TGAAGGATGCGTGTGGGCATGGGACGGCATGGGAGTGTTTTGACGAGGAG
AGTACCGGTATGAGTGGGAAAGGGAAGGGACGGGAACAACCACGGGGGTC
CACATCGAACAATAGCGCAAAGAAAGACGCAGTCGACCTTACCAACGACG
ACTCCCAGGCACCACCTCCCAACTGCAAACCTCAAACCCTCAACCCACCA
TTGGCACTGCCAAACCCTCAAAATCCCATCCTATCCCTTTCCTCTCGCCC
TAAGGCCAAGGCCCCCAACGAGGCTTCAAAAACCACCTGCACCGCATGCT
CATTCGCTAACGACCCAACGTCGACGCTGTGCTGTGTCTGTGCTAATGTT
TTAAATCCTGGGCGTATGAAGAATGCATGGAAGTGCTCGTGT

Sequences in the Contig:

SY0AAB27YL06FM1