Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YI04FM1
Length(NT) : 695
Best Gene Model Blast : Link to GSTUMT00011339001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_00273
Accession: ref|XP_001219494.1| Score: 130 E_value: 5e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB27YI04FM1
TTGGCAATGACCACTGTGAGAACCTGGATTCGTCGAAAAATGTCTAAGCG
GCCGAAAGCCATGAAGCTACCGGTTGATGATGAGATCGATTGGGTTGCAG
TGAGGATTGGGGCGTCCCAAGATGCGCTTTGGAAGCCCAAACCCAATGGG
CCGGAAGGTGCTCGCGACAGTGATCCTACCTGGGAGGTAATAACCCTCCA
TGGGTATCTCGGATATAAGGGTGCTTATGCGGGGCATATCGCGCCTATAG
GAGAAGCACAAGCGATCCTTGGCTTGCGAAAGGACCTCGGAGATCTCATG
AGCTGGGATGAGATCTCTTATTCCTTTGCGTCGAAACTAGTCGAGTGCCT
TCAATCTTTGCTATTCTATTTTATAGACTCGGGGGAAATAGCCCTTGCCA
AGACCGTCACACGTCCCGCCGTTCTTCACTGGGCACTGCCGGTCAAAGTC
GGTGGGACAGTGCAGTATATAACCATGACTGCCTCAAGGGGGAGTTCGTT
CCAATGGAATGTGGATACATCTGAGCTCTGCGCCGTGATCTCCCTCTGGT
GTTATGGAGTTAAGTCGAAGGACATTCAAAATACCTACAAGTACTGGAGT
TATAGGGCTGACCCTGAGACGGTCTTACGAGTGCTTGGGCCGGCAACTCA
CCGATTCGTTAGTGACTGCGAGCGGTGGATGGATAGGGGGGGGAG

Sequences in the Contig:

SY0AAB27YI04FM1