Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YC09FM1
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00010176001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ORF2
Accession: dbj|BAA07467.1| Score: 133 E_value: 2e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: RnaseH, RNase H. RNase H digests the RNA strand of an RNA/DNA hybrid. Important enzyme in retroviral replication cycle, and often found as a domain associated with reverse transcriptases. Structure is a mixed alpha+beta fold with three a/b/a layers..
Pfam Number: pfam00075 Score: 117 E_value: 4e-07

Sequence:
>SY0AAB27YC09FM1
TTGGCTTGGTACGAGAATGACAATATACGACGCGGAGCTATACGCCATCT
GGAAGGCCATAGGCCTCGGCGGTCGTGTAGCTCGCGAACGCGGGGCGAAG
AAATTGACCATATGCGCTGACAGTCAGGCCGCTCTCGGCGTGATGGCTCG
TGGCACGATCGGCCCTGGAAGCCACCTTGCCCTCCGTGGCCGTGCCCAGA
TGAAAGACCTTCACCACACACACGGCATTGATGTCGCGCTCGAATGGGTC
AGGTCCCATGCGGGCATACGCGGGAATATCCGCGTAGACAAACTCGCGCG
GGCGGCGTGCGCGATCAGACAGAAGCAGAAGGATAGCTACACTAGTGAGA
TACTGGCCGAGAGGAGACGGAGCAGGGAGGAGTGGGTTCGGGGATGTAGG
GAACGAAGGTTGAAGAGGTGGAAGGCTGCGAAGACAGAGGCGGAGGAGGA
GATGGAGGCCAAGCCAGTGAATTATGTGGTTAATACGGGTTATGGTAAGT
CTCCGTTTAAAGAGTATGAGGCGCCGGTTGTTGTGCATTATTAGGTTGGG
TTGGGATGTATATATAGCTGCGGATTAAATTTGTGTATGTGTAAGTAGGC
GGAGGGGTAGAATCGCT

Sequences in the Contig:

SY0AAB27YC09FM1