Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB27YA02FM1
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00011242001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NFIA_104060
Accession: ref|XP_001266815.1| Score: 404 E_value: 7e-38
KEGG Definition: hypothetical protein
Accession: ani:AN3652.2 Score: 346 E_value: 2e-31
KOG Definition: No Hit Found
PFAM Definition: Ribonuc_P_40, Ribonuclease P 40kDa (Rpp40) subunit. The tRNA processing enzyme ribonuclease P (RNase P) consists of an RNA molecule and at least eight protein subunits. Subunits hpop1, Rpp21, Rpp29, Rpp30, Rpp38, and Rpp40 (this entry) are involved in extensive, but weak, protein-protein interactions in the holoenzyme complex..
Pfam Number: pfam08584 Score: 359 E_value: 3e-35
Swissprot: O75818|RPP40_HUMAN
Gene Ontology:
GO:0005655 = Cellular component: nucleolar ribonuclease P complex
GO:0005515 = Molecular function: protein binding
GO:0004526 = Molecular function: ribonuclease P activity

Sequence:
>SY0AAB27YA02FM1
TTGGCACCATTACCAAAATGCTATATATCTGTGCACAAACCACCAGAGAA
GACCACCTTACCACATCCTTTCAATCACCTTGTTGACCTCTTACTTCCTA
CCGATCTTTACCAACTTATATCTAACGACTTGGAATCGTCACCCACGCTA
TCTAAACCGCTACTATGTCATCGAATGTCGATACCTCTATCGGCGATAGT
AGAGGCTGAATTTCTTACGAAGTATATAAAGACAGGCAATGTTATAATGC
TCTCTAGAGGCCGAATCGACATTGACAATGTCTTCTCGCTTAACGACGGG
ATACTTCGCCTTTCACTCACGAAAGAAGCATACGAAAAAACGGGCTTAAC
TGGGCAGCCCACACGCTTCGGGAATACAGGCCCTAGAAAAAAGCATAACC
GACATCTGGTTGAAATAAACCTCCGTGACCCAGCTATGCTCCATGGAAAG
AAAGGCTTTGACCGCGTAGTCTGGAGTTTCCAGAATAAACTCAATATGAA
AGTCGATTTCTTGTTTTGCGATTTAGACCAACAGAAAAATCCTATAGATT
GCCCAATACTCGCAGCGTTGGGAGCTGCTCCCCGACAGGTTCAAGTCCCG
GAGGTAACTTCGTCAAGCCCGGTTAAAGT

Sequences in the Contig:

SY0AAB27YA02FM1