Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YO05FM1
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00011380001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001591458.1| Score: 553 E_value: 5e-55
KEGG Definition: NDR and related serine/threonine kinases [EC:2.7.11.-]; K08286 protein-serine/threonine kinase
Accession: aor:AO090012000420 Score: 484 E_value: 2e-47
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0605 Score: 467 E_value: 1e-47
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 267 E_value: 2e-24
Swissprot: P38938|CEK1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0007346 = Biological process: regulation of mitotic cell cycle

Sequence:
>SY0AAB26YO05FM1
TTGGCTCTTAGCCGAGAGAACTCTTTGAGAAGATCATCTAACCCGAGAAG
TTATACCAGTGGGAGCGATCATCTGATCTCCATGCTGGGCAGCTTCAGCC
TCAATGATCCCCATATGCACAGTACCCTCTTCAACAATCGGAAAACCCCT
ACAGGAGACGAAGATGTTCAGAGTGAGAGCAGTACCTCGAGCGACTTCAG
CAATGGTCTATGCCTCCAACATATGACTTCATATCCCAGCCCAGCCCAGA
GCCAGATCCAGCACCCTCCCCAACCAATGATGCCGCCTCAACTCGCGCTC
TTTGACCCCGAGGATAATAACCGAAAGTTTGTTGGCACTCCTGACTATTT
GGCCCCGGAAACTATCAAGGGCAGTGGGCAGGATGAGATGAGTGATTGGT
GGTCCCTCGGTTGCATTTTGTTTGAATTTTTGTACGGGTATCCCCCCTTT
CATGCGGATACTCATGATAAGGTGTTTGAGAACATATTGAACCGGAGGAT
CGATTGGCCAGATCCAGAGGATGACGACGTCTCAGACGAGGCAAAGCATT
TGATGAACCGGCTCATGTGTACAGACCCTAACCAGCGACTGGGTGCGAAT
GGCGCCGAGGAGGTTAAAAGGCACCCGTGGTTTGCAAGTCTCAATTGGGA
GACTCTACTTGAAGAGCAGCCATCATTCGTGCCGACGCCCCAAGATCCC

Sequences in the Contig:

SY0AAB26YO05FM1