Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YN21FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00003151001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU07715
Accession: ref|XP_962301.2| Score: 157 E_value: 3e-09
KEGG Definition: hypothetical protein
Accession: ncr:NCU07715.1 Score: 157 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB26YN21FM1
TTGGTCCTCAGACCCGAACCCGAGTTCGAAGTTTTGAAGGATCATAGATG
TCACAAATCGGCCGAAAACTATTACTTCAAGTTCCAACTCTACTATTTCT
CTCCCCATCGAATTCAACTGGTATCCCGATAAGGACACTGCCGAAGGCTG
CATCGGTCCGCATTCTTTGATGCAGGAATGATGGTTCCCCCTTTGGACCC
CCGTGACCCCCGCGACCTCCACGCTCGCCCATGGAAACGGCGTTCCTCTT
CCGTCTCCGCCCCATACTTCCGCCTTCCTCGACGCAGTCGTCGCGCAACT
TATATCTGCTGGACTGTTGTGGTATTTGTGCTTTATTTCGTTCTCAATTC
GGCAACGCAGTGGTCCCATGTACCAGATCCGAGATCTTTCTACAGCAAGG
GTAGCAACGTTCCGATCCAGTACCCTAATTTATACCCTAGCCTTTCAAAG
ATTACGGGCGGCGGAAACAGAGCTTGGAATAGGAATGTACTGTTCGTGGC
AGGGAATCTAGATGCGGCTAGCAAACTTGCCGGAATTGCCTGCGAGATGT
CCATGTATGGGAGGAGCAATGTCCATTTTGCACTGATAGGAGATAGCAAC
ATGGATATGGAGCTCTTTCGGGAGCTCAAT

Sequences in the Contig:

SY0AAB26YN21FM1