Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YN02FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00009761001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An01g03540
Accession: ref|XP_001388784.1| Score: 222 E_value: 1e-16
KEGG Definition: hypothetical protein
Accession: ang:An01g03540 Score: 222 E_value: 5e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB26YN02FM1
TTGGCTATCGCCGGCTCTTTCACTTTATAAGGAGTCCTGACAAATACGTT
AATGGTCCGTTCCTTAGTGGTTTCGAATTTGGCAACTCGAAAGTTCTTGG
GTGCACCACTTCAAATACGGAAGCTCGATTTCATTCGTGCGAAAAGAGGA
TTGGATGCAAGGGCCTTGAAGGAAGGAAGAACATTGTTTGGATCAGCCCA
GTCATTACAAGAGTGGGGTCATATGATGTTCACGAACCTGGCGTCGGGAG
TGGTGATTTAGAAAACCAGGATGATCTAGAACTACGGGATGAGCACTTGA
AACAGATCCTCGAGATCCTGGGGCCAGATGTTCCGGAGAGCGTTAGGGAT
CTTTTGAAGGAGGCAAGGACATCCATGAAACAATTGCTCCCGCTGTCTCT
CCAGAGAGGTTCCGAGGAGGATGACCTGACAGCACCCAAACTCCTAGGGC
TGCTATCCGAAGCAGCGGGTATATCGAGTCAGCGAAAGAGCCAGGAGACC
GACTCTCAGATCCTCATTCCTACTCCCATAAGTAACGATGAGGAAGGGGT
AGTTGCAGAGAACGGAGAGATCCTCCCGAATGTGATCACCTTCCCCTTTT
CACGCCACTCTTCGTACTCAGAGCTACGCGGTTTAGTATCTGCTTTCAG

Sequences in the Contig:

SY0AAB26YN02FM1